Notícia

Clínica Veterinária

Detecção molecular do rearranjo Line-1/c-MYC em tumores venéreos transmissíveis caninos espontâneos

Publicado em 01 novembro 2010

Resumo: O tumor venéreo transmissível (TVT) é urna neoplasia que se desenvolve em condições naturais no cão. É de fácil transplantação, demonstrando a capacidade de transmissão de um animal para outro. Pelo fato de o rearranjo Line-1/c-MYC ainda não ter sido estudado nas células do TVT no Hospital Veterinário da FMVZ, Unesp, campus de Botucatu, SP, este estudo teve por objetivo detectar o rearranjo, uma alteração genética específica desse tumor, por meio da reação em cadeia da polimerase (PCR). Para tanto, foram utilizados vinte cães com diagnóstico citológico de TVT Amostras das células tumorais foram colhidas para se detectar a presença do marcador Line-1/c-MYC. O rearranjo caracterizado por amplicons de 340pb de tamanho não variou nas amostras, em concordância com descrições anteriores, contribuindo para a identificação mais precisa das células neoplásicas persistentes em casos nos quais o neoplasma não seja macroscópica ou microscopicamente detectável, o que poderia ocasionar a recorrência do tumor em questão. Unitermos: cão, punção aspirativa, DNA, extração, PCR, amplificação

Introdução

O tumor venéreo transmissível (TVT) é uma neoplasia que em condições naturais se desenvolve no cão, na região genital e extragenital de ambos os sexos, em animais que atingiram a puberdade1-3.

Apesar de intensa investigação, alguns pontos sobre a neoplasia permanecem controversos. A etiologia, origem histológica e origem genética são alguns dos fatores que permanecem incertos. Até o momento, não houve nenhuma constatação do envolvimento de algum agente físico, químico ou biológico na origem dessa lesão, nem tampouco de a origem histológica da célula ser epitelial ou mesenquimal. Além disso, a constituição cromossômica dessas células é semelhante à de uma célula somática canina normal em relação à presença de diversos rearranjos4-6.

Dentre as várias formas de coleta de amostras desse tumor, a mais adequada é o exame citológico, por punção, pois reduz sobremaneira a contaminação por sangue e seus constituintes, isolando grande quantidade de células de TVT ideais para o cultivo celular e/ou a obtenção de DNA/RNA para a pesquisa de marcadores moleculares e de expressão gênica7.

Os avanços da biologia molecular nos últimos anos tiveram grande impacto, não só pela disponibilidade de novas metodologias em busca de mutações por sequenciamento de DNA, mas também por uma mudança de conceito para o diagnóstico, prognóstico, monitoramento e entendimento das doenças8-11.

Utilizando essa metodologia, pode-se identificar e quantificar a expressão dos genes individuais com importância específica para um determinado tumor 12-13.

Entre os vários rearranjos cromossômicos dessas células neoplásicas, o que se dá entre um elemento transponível (Line-1) e o gene MYC é um dos mais característicos. Esse rearranjo caracteriza um ótimo marcador molecular para células de TVT, uma vez que sua presença não é detectada em células somáticas normais tornando-o um marcador molecular de alta especificidade para o TVT. No ser humano, o gene c-MYC encontra-se na posição 8q24.1 e tem como função em células normais a regulação de transcrição de fatores com ação nuclear, compreendendo três éxons, cujos produtos consistem em fosfoproteínas nucleares altamente conservadas. As descobertas acerca desse gene reforçam sua atuação como modulador da transcrição gênica e sua participação em outros mecanismos potencialmente relevantes no processo carcinogênico. 14-15

Quanto aos elementos de transposição, eles representam aproximadamente 17% do genoma humano e são sequências de DNA que podem se mover no genoma, caracterizando a principal fonte de mutações espontâneas. Também podem causar efeitos deletérios, culminando com o desenvolvimento de várias doenças no ser humano 16-18. O grande número desses elementos no genoma propicia ampla oportunidade para recombinação homóloga desigual, ocasionando deleções ou duplicações gênicas, ou mesmo alterações mais complexas do material genético19-20.

No TVT, pesquisadores encontraram o oncogene c-MYC rearranjado pela inserção de um elemento longo de transposição Line-1 na região da extremidade 5" para o primeiro éxon. Por meio das técnicas de biologia molecular, essa junção foi detectada em todas as amostras testadas desse tumor, porém não foi observada em amostras de DNA de células normais de cães21-23.

A junção Line/c-MYC é um rearranjo entre dois genes expressos nas células neoplásicas do TVT. Já foi detectada em células de TVT em diferentes países, sempre associada apenas às células neoplásicas e não às células somáticas normais. No entanto, a detecção desse rearranjo ainda não foi descrita em TVTs espontâneos no Brasil. Dessa forma, este estudo teve por objetivo detectar o rearranjo Line/c-MYC e adequar a metodologia já descrita para avaliar a ocorrência do rearranjo Line/MYC para diagnóstico específico da presença de células neoplásicas de TVT espontâneo em animais atendidos no Hospital Veterinário da Unesp, campus de Botucatu.

Material e métodos

Foram utilizados vinte cães sem restrição de sexo, raça ou idade provenientes da rotina do Hospital Veterinário, FMVZ/Unesp, campus de Botucatu. Todos os animais tiveram diagnóstico citológico positivo de TVT. As células tumorais foram coletadas por punção aspirativa, colocadas em um criotubo contendo solução tampão fosfato PBS e conservadas a -20 °C para extração de DNA genômico. A digestão proteica foi realizada em 500jliL de tampão de digestão (Tris-HCl lOMm pH 8,5, EDTA lMm pH 8,0, Tween 20 a 0,5%, protei-nase-K 400jng/|uL). As amostras foram então incubadas a 65 °C, durante 24h. A extração do DNA seguiu-se de adição de CTAB/NaCl, com posterior precipitação do DNA com etanol, formação de pellet por secagem e diluição em solução de Tris HC1 1M pH 7,5 e EDTA 250Mm ou água ultrapura estéril. A quantidade de DNA foi avaliada por leitura em espectrofotômetro digitala, e sua qualidade,, avaliada por eletroforese em gel de agarose a 2%, corado com brometo de etídio.

A presença do marcador Line-l/c-MYC foi avaliada por meio da reação em cadeia da polimerase (PCR), com a utilização dos primers MYC.S (5" ATGCACCAAGATTTTCTTCACTGC 3") -específico para o gene MYC - e Line.A (5" ATCCTAGAGAAGAACACAGGC A AC AC 3") - específico para o segmento Line-1 -, disponíveis no banco de dados do National Centre for Biotechnology Information (NCBI, 20IO)24. Dois primers específicos para o gene de hemoglobina humana foram utilizados como controles internos positivos de reação de amplificação HBGA.S (5" CGGTATTTGGAGGTCA GCAC 3") e HGBA.A (5" CCCACCAC CAAGACCTACTT 3"). Cada reação foi feita em volume final de 25liL contendo lOpmol de cada iniciador, 2,5mM de cloreto de magnésio (MgCl2), 0,28mM de dNTPs e 1U de DNA polimerase \ O perfil de ciclagem utilizado foi 94 °C por 5 min., seguido de 35 ciclos a 94°C por 1 min., 64°C por 1 min. e 72 °C por 5 min. O tamanho de peso molecular esperado é de 340pb. Todas as reações de amplificação foram realizadas juntamente com um controle negativo para contaminação (ausência de DNA) e um controle negativo para o rearranjo utilizando DNA humano na reação.

Os produtos de amplificação foram submetidos à corrida eletroforética em gel de agarose a 2% por lha 100V, contracorados com 0,3% de brometo de etídio em trisborato-EDTA (TEB) a 10% e visualizados sob exposição a luz ultravioleta. A presença do rearranjo foi encontrada por amplificação específica de um fragmento de 340pb, distância entre os pontos de ligação dos iniciadores utilizados quando o rearranjo está presente (Figura 1).

Resultados

A punção aspirativa permitiu a coleta de número adequado de células para a realização da técnica proposta. Houve necessidade de se realizarem testes para a indicação da temperatura mais adequada para anelamento dos primers MYC.S e Line.A, com o intuito de padronizar a reação da PCR. Assim, expusemos doze amostras de DNA de TVT a doze temperaturas diferentes, que variaram de 50 °C a 70,5 °C (Figura 2).

Realizou-se a corrida eletroforética das amostras, verificando que a amostra seis apresentou padrão de sonda de melhor qualidade quando exposta a temperatura de mais de 58,1 °C, definida como temperatura ótima para as ciclagens subsequentes. Também se variaram as quantidades da enzima Taq DNA polimerase nas reações, com o intuito de minimizar o gasto e maximizar os resultados.

A sensibilidade do teste para a detecção do rearranjo Line-l/MYC foi avaliada por meio do uso de diversas diluições de amostras. O DNA extraído de células de TVT foi diluído com DNA extraído de células de sangue de cães clinicamente sadios, na proporção de 1:25, 1:50 e 1:100. A reação para detecção do rearranjo se mostrou adequada para identificar células de TVT em todas as concentrações testadas, mesmo quando o DNA de células de TVT estava presente em uma proporção de 1:100 de células normais (Figura 3). Ainda, todas as vinte amostras testadas se mostraram positivas para a presença do rearranjo e nenhuma amostra de sangue de cão normal se mostrou positiva para o rearranjo, fato esse que comprova a especificidade da reação.

Discussão

O método de punção para a coleta das amostras foi considerado adequado para a aplicação da PCR empregada neste trabalho. De fato, como já preconizado por outros autores, reduziu a contaminação por sangue e seus constituintes, conferindo alta celularidade, o que contribuiu com um melhor resultado da técnica molecular aplicada - no caso, a PCR25.

A conservação das amostras e a posterior extração do DNA apresentaram resultados satisfatórios quando comparados com os dos trabalhos que utilizaram procedimentos semelhantes26-28, tais como o armazenamento por longo período à temperatura de -20 °C, possibilitando a aplicação em futuras pesquisas.

Porém, esses autores não especificam em seus relatos qual seria o período máximo para armazenamento das amostras sem comprometimento da qualidade do DNA, dado de fundamental importância no artigo científico. O protocolo de extração utilizado por nós com a mesma temperatura - de -20 °C, por nove meses - não alterou a sensibilidade e a especificidade da PCR; consequentemente, obteve-se a detecção do Line-l/c-MYC em todas as vinte amostras 29. Diante disso, consideramos que nove meses é o tempo de armazenamento ideal para futuras pesquisas, dado até o momento não relatado na literatura especializada no assunto - o que mostra o ineditismo de nosso trabalho.

A reação em cadeia da polimerase (PCR) demonstrou-se neste estudo um método de fácil execução, simples, rápido e de extrema sensibilidade para a detecção do rearranjo 11,30, em que se pôde obter grande quantidade de DNA de um gene específico a partir de uma quantidade mínima de DNA, como preconiza a literatura10. Com relação à padronização desse método molecular, obtivemos ótimos resultados quanto ao método de ciclagem das amostras quando várias temperaturas e números de ciclos foram testados, como realizado em outros estudos moleculares que utilizaram protocolos semelhantes29.

Quanto às diluições utilizadas de 1:25, 1:50 e 1:100, não foram encontradas na literatura tais diluições do DNA genômico para diminuição dos custos desse teste - cujo propósito foi averiguar a possibilidade de utilizá-lo em cães em final de tratamento, quando os métodos tradicionais não são capazes de detectar as células tumorais na região. O protocolo final alcançou o objetivo esperado, com boa definição em gel de agarose, o que reduz os custos do teste.

A detecção do rearranjo genético encontrado em nosso trabalho e o tamanho da amplificação, que foi de 340pb, diferiu de outros autores25,31 que verificaram tamanho da amplificação de 550pb para o segmento 5" do referido rearranjo, no qual a sequência do Line-1 possuía 1.3378pb flanqueados por 10pb em repetição direta upstream para o gene c-MYC. Entretanto, os produtos da PCR dos oligonucleotídeos variaram em comprimento, onde esse rearranjo encontrava-se em 416pb por uma sequência homóloga inversa. Essa variação pode ser explicada devido ao fato de a utilização de outros primers amplificar em uma região diferente. Para isso, é necessário aprofundar as investigações relativas a esse assunto.

Nossos resultados estão de acordo com a literatura especializada, em que se encontram relatos de outros pesquisadores que testaram por meio da PCR a amplificação desse segmento de DNA em outros tumores, constatando a ausência do rearranjo Line-l/c-MYC. No entanto, a literatura cita a necessidade de mais estudos para saber qual o verdadeiro papel desse evento na carcinogênese, bem como do mecanismo do elemento de transposição Line e seu verdadeiro papel no desenvolvimento da neoplasia32.

Considerações finais

Concluiu-se que a técnica da PCR para detecção do rearranjo Line-l/c-MYC nas células de TVT canino espontâneo em cães, em amostras armazenadas em temperatura de -20 °C por nove meses, apresenta alto grau de especificidade para pesquisa do rearranjo genético em questão. São necessários mais estudos a respeito, pois a sensibilidade dessa alteração genética é indiscutível para a carcinogênese do TVT, como apresentado neste trabalho e unânime na literatura especializada, porém ainda não foi demonstrado que essa alteração seja a causa primária e única dessa neoplasia.

Agradecimentos

Agradecemos à FAPESP e ao PIBIC/CNPq pelo suporte financeiro.